keelie3804 keelie3804
  • 05-03-2019
  • Biology
contestada

Why to tropical plants have more stomates than desert plants?

Respuesta :

brainiac2902 brainiac2902
  • 05-03-2019

During this process, stomata on a plant's leaves and stems open to absorb carbon dioxide from the air and in return release oxygen. Each time a plant opens its pores, some water escapes. This is called transpiration. ... So desert plants have acquired special adaptations that help them reduce water loss.

Hope that answers your question

Answer Link

Otras preguntas

What is the additive inverse of -4a
I want to work with LDAP. what is LDAP?
How do you put allele in a sentence
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
what rule does static electricity follow
Step by step directions Square root for 480