Nightlock3457 Nightlock3457
  • 03-06-2018
  • Mathematics
contestada

Find the domain of the function f(x)=12x+3. what is the only value of x x not in the domain?

Respuesta :

Luv2Teach
Luv2Teach Luv2Teach
  • 06-06-2018
The domain of that function is all real numbers because it's a line.
Answer Link
Vespertilio Vespertilio
  • 28-08-2018

The function given to us is[tex] f(x)=12x+3 [/tex]. As we can see this is a linear function and thus, it function will have no value of [tex] x [/tex] such that the function is undefined there. Therefore, the given function's domain will be the set of all real numbers. In other words, this can be written as:

Domain of f(x): \mathbb{R}

Thus, D:\left \{ x:x\in \mathbb{R} \right \}

where symbols have their usual meanings.

Answer Link

Otras preguntas

How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the range of function of y-1=(x+3)^2
Companies raise funds to expand their business by
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Why was wilson not able to finish his speaking tour
how do you know 8 thousandths is less than 1 hundredths
What were the driving forces behind the industrial revolution
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?