WhyAreWeStiIIHere WhyAreWeStiIIHere
  • 01-12-2020
  • Chemistry
contestada

What do the three types of mixtures have in common?
(colloid, solution, suspension)

Respuesta :

alexsidorenko alexsidorenko
  • 04-12-2020

Answer:

A colloid is a heterogeneous mixture in which the dispersed particles are intermediate in size between those of a solution and a suspension. The particles are spread evenly throughout the dispersion medium, which can be a solid, liquid, or gas.

Explanation:

Answer Link

Otras preguntas

A 2-m3 rigid tank initially contains air at 100 kPa and 22oC. The tank is connected to a supply line through a valve. Air is flowing in the supply line at 600 k
Put these in order from least to greatest 1/2, 1/3, 2/5, 0.6 , o.3
Find the length of a pendulum that makes one swing in 3 s. The equation for the time of one swing of a pendulum is T= 2pi sqrt(L/32) , where T is the time in se
Define immortalizing and blasphemy. Give three synonyms and antonyms for each word. Use each word in a sentence.
What role does the immature prefrontal cortex play in young children's blossoming creativity?
Translation takes place in the what on a what?
why is it important for a germ to change over time
A line segment has an endpoint at (3, 2). If the midpoint of the line segment is (6, -2), what are the coordinates of the point at the other end of the line seg
Describe what scientists mean when they refer to an ecological community such as that shared by the leopards and lions.
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA