Jay1023
Jay1023 Jay1023
  • 02-11-2016
  • Mathematics
contestada

how do i solve for x (16x+22)=134

Respuesta :

karen1630
karen1630 karen1630
  • 02-11-2016
first off u have to distribute x times 16x so u add a 1 in the x like in front of it so u would get 16x + 22 = 134....
THEN you have to minus 22 by bothe sides so -22=-22 
so then you're left off with 16x=112 divide 16 both sides so your final answer is x=7 

sorry if its hard to comprehend 
Answer Link

Otras preguntas

does a human body use neon???
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
what was paul revere failures
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the range of function of y-1=(x+3)^2
What statement best describes a republic?