silviadorothy8 silviadorothy8
  • 02-06-2021
  • Physics
contestada

Give 2 reasons for fitting heavy commercial vehicles with many tyres​

Respuesta :

drrani79
drrani79 drrani79
  • 02-06-2021

As we know larger the area of contact lesser the pressure. So, in order to reduce the pressure heavy vehicles have broad tyres to increase the area of contact with the ground. Heavy vehicles have broad tyres because broad tyres have large area of contact and less pressure on the ground.

mark me brainliesttt pls :)))

Answer Link

Otras preguntas

all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Write expression using the distributive property to find the product of 7 times 63
what are 2 examples of ionic compound?
what are 2 examples of ionic compound?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow