BratburuAlla BratburuAlla
  • 03-02-2017
  • History
contestada

Why did woodrow wilson won the election of 1912?

Respuesta :

crista4ever
crista4ever crista4ever
  • 03-02-2017
 Woodrow Wilson was president because the Republican Party had split
Answer Link

Otras preguntas

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors
What type of government did germany, italy, and japan have in the 1930s? (world war ii and postwar america unit, lesson 1)?
What is the difference between a settler an an explorer social studies?
Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1
Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?
Why do you think it is a good idea to soak wilted lettuce in cool water before serving it?
The dodecahedron can be constructed from the repetitive folding of _____. A. equilateral triangles B. squares C. triangles D. regular pentagons
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
What is a sample vs a population
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat