ZeroNakamura ZeroNakamura

01-05-2017
Mathematics

contestada

What is the first step to solving this equation? 4y – 10 = -3

Respuesta :

aliyahmcintosh7 aliyahmcintosh7

01-05-2017

add 10 to both sides of the equation

Answer Link

ricardoconcepci ricardoconcepci

01-05-2017

I would say either analyze it or move the 10 to the other side and change the sign. (4y=-3+10)

Answer Link

Otras preguntas

40. Sixty-four teams have entered a slow pitch baseball tournament. A team is eliminated after one loss. How many games must be played to determine a winner?

Madi is going to the gym, she only has $53.27 with her. It is $15 per hour, she works out for 3 hours, she bought a snack bar for $2.57, how much money did she

What is your personal heart rate zone show your calculations why is it important to keep your heart rate and your target heart rate zone

100 points!!!! When are double negatives acceptable to use? Why? When can the rule be broken? Context on the question: The rule of a double negatives is that

If a girl in a bikini has walked 4 KM in 10 minutes, How many kilometers does she walk in 3 years?

based on the reaction in the animation, what can you say about the change in free energy of the cleavage of sucrose into glucose and fructose?

Why do people believe that the media has grown to equal the status to the family about shaping political views?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Please answer fast | \/

Hello everyone, I need help on this Math question (: