katiewillison1ox7lbg katiewillison1ox7lbg

02-10-2017
Health

contestada

Salvador is 66 inches tall and weighs 200 pounds.Which diet would be best for Salvador to ensure he's at a healthy weight?

Respuesta :

puppetlover2000 puppetlover2000

08-11-2017

It's the 2,000 to 2,200.

Answer Link

shuteenlemery44 shuteenlemery44

02-08-2020

Answer:

he can try diffrent diets inttermittent fasting keto, Restricting calroies,

Explanation:

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

A coordinator will select 4 songs from a list of 11 songs to compose an event's musical entertainment lineup. How many different lineups are possible?

How did the structure of the Articles of Confederation support states' rights? States made all the decisions for the country and were not bound to the national

Use the multiplier method to decrease £262 by 39%You must show your working.

In a certain town there were 243 robberies last year. This year the number of robberies has gone down 28%. How many robberies were there this year, to the neare

33) What, to the American slave, is your 4th of July? I answer: a day that reveals to him, more than all other days in the year, the gross injustice and cruelty

On day two of the class your element is 12 g. On day 7 of the class your element is not 58 g. What is the rate of growth, as a percentage?

Zinc(II) sulfide reacts with oxygen according to the reaction: A reaction mixture initially contains 3.0 mol ZnS and 2.0 mol O2. Once the reaction has occu

The rotation period for Venus is___days. (pls help!) 365 186 512 243

This Question has been deleted