makenaterrellth makenaterrellth
  • 01-12-2017
  • Spanish
contestada

Voy a pescar en el lago. ¿Cómo va a ser?

Respuesta :

crazyminion crazyminion
  • 01-12-2017
voy a usar una red para pezcados y carne para que el pescado se atraiga ala comida y quiera comer..........
Answer Link
julietaaudrynowu6zf julietaaudrynowu6zf
  • 02-12-2017
Será divertido. Usaré una caña de pescar y un cebo para atrapar los peces y usaré gusanos para que los peces se lo coman y se peguen a mi carnada
Answer Link

Otras preguntas

Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
what rule does static electricity follow
2ln(5x)=8 solve for x
What is the sum of 6/10 plus 7/12
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
I want to work with LDAP. what is LDAP?
what might be learned from an incorrect hypothesis
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland