icorral209
icorral209 icorral209
  • 03-03-2018
  • Mathematics
contestada

Jonathan has collected of 400 marbles. Blue marbles make up 17% of his collection.

Respuesta :

Astute
Astute Astute
  • 03-03-2018
Hello there!

Based from this question above, what this is asking is to find how much does 17% goes into 400 marbles.

We want to know how many marbles are in this 400 marbles. (This would be the key point)

We do (17% x 400).

By putting the "%" symbol this allows us the understand that we are trying to find out how many blue marbles they're going to be.

By multiplying them both together, we got our answer as (68) marbles.

Your correct answer would he 68.

I hope this helps you!
Answer Link

Otras preguntas

is a centimeter one tenth or one hundredth or a meter
The Panama Canal connects what two bodies of water?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
when Jefferson took office he did what
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Where did middle names come from