Chase5111 Chase5111

01-05-2018
Mathematics

contestada

The diameter of a cylinder is 6cm and the height of it is 12 cm. What’s the area of base and the volume?

Respuesta :

MrGumby MrGumby

03-05-2018

Area of the base: 9[tex] \pi [/tex]

Volume: 108[tex] \pi [/tex]

Answer Link

Otras preguntas

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

The orbital speed of theEarth is about 30 km/s, compute the centripetal acceleration in m/s2 of the Earch in its nearly circular orbit about the Sun (r = 1.5 ×

Bellingham, Washington, has an area of 25.4 mi2 and a population of 74,547 during one year. Bakersfield, California, has an area of 113.1 mi? and a population o

What are the magnitude and direction of w = ❬–5, –14❭? Round your answer to the thousandths place.

What is the wavelength of the wave shown below?A.0.5 cmB.2.4 cmC.0.4 cmD.1.0 cm

What’s your question represents our relationship shown in the graph

Triangle is rotated 180° around the origin. What will be the coordinates for Triangle J'K'L'? A(6,7)(6,2)(3,7)B(7,-6)(2,-7)(-3,-7)C(-6,-7)(-6,-2)(-3,-7)D(-7,6)(

Find all values of y such that the distance between (5,y) and (-7,2) is 18.

Based on sample data, newborn males have weights with a mean of 3242.4 g and a standard deviation of 844.4 g. Newborn females have weights with a mean of 3095.9

could you please help me